SRM Journal of Research in Dental Sciences

ORIGINAL ARTICLE
Year
: 2012  |  Volume : 3  |  Issue : 4  |  Page : 231--235

Influence of various environmental conditions on DNA isolation from dental pulp for sex determination using polymerase chain reaction


Suresh Vemuri1, R Ramya2, K Rajkumar2, P Rajashree1,  
1 Department of Oral Pathology, Lenora Dental College, Raja Nagar, Rajahmundry, India
2 Department of Oral Pathology, Sri Ramaswamy Memorial Dental College, Ramapuram, Chennai, Andhra Pradesh, India

Correspondence Address:
R Ramya
Reader, Department of Oral Pathology, SRM Dental College, Ramapuram, Chennai
India

Abstract

Objective: To determine the reliablility of sex determination by polymerase chain reaction Materials and Methods: Extracted teeth were subjected to the following treatment: Varying temperature (100, 200, 300, and 400°C), immersing in sea water (20-36 days), and burying at 30-cm depth. After subjecting to specific environmental stress condition, DNA (Deoxy Ribonucleic acid) was extracted from the tooth pulp. Primers Y-chromosome specifi c alphoid centromeric repeat sequences DYZ3, X-chromosome specifi c alphoid centromeric repeat sequence DXZ1 were used for sex determination by PCR. Results: Out of 15 samples subjected to various environmental conditions, DNA was isolated in 13 samples and sex determination was carried out. There was no DNA yield when teeth were subjected to high temperatures (300, 400°C). The DNA analysis after the respective PCR showed accurate sex determination of the 13 samples. Conclusion: our study showed that teeth are reliable source for sex determination even when subjected to different environmental conditions except during extreme high temperatures. Hence, sex determination by PCR analysis is the most reliable method in markedly decayed or preadolescent bodies.



How to cite this article:
Vemuri S, Ramya R, Rajkumar K, Rajashree P. Influence of various environmental conditions on DNA isolation from dental pulp for sex determination using polymerase chain reaction.SRM J Res Dent Sci 2012;3:231-235


How to cite this URL:
Vemuri S, Ramya R, Rajkumar K, Rajashree P. Influence of various environmental conditions on DNA isolation from dental pulp for sex determination using polymerase chain reaction. SRM J Res Dent Sci [serial online] 2012 [cited 2019 Nov 13 ];3:231-235
Available from: http://www.srmjrds.in/text.asp?2012/3/4/231/114966


Full Text

 Introduction



Odontological examinations have been a critical determinant in the search for identifying human remains where positive identification is not practical due to decomposition or destruction of the soft tissues. The ability of the inert, mineralized structures of teeth to resist post-mortem degradation and to survive deliberate, accidental, or natural change has led analysts to focus on the teeth as a possible source for valuable forensic data. [1],[2] Sex determination is the first step in personal identification and is usually done by studying the anatomical characteristics. However, in markedly decayed and skeletonized bodies, bone and teeth are the only available materials. [2] Bones in the cranium and pelvis can help identify the sex, but it is difficult in preadolescent bodies, where teeth can be the only reliable source. [3],[4]

Teeth enamel is the hardest tissue of human body and teeth remain intact for longer period after death. For this reason, many studies have been carried out to determine an individual's sex according to sexual differences in the anatomical morphometry of teeth (male and female). [5] However, sex differences in dental morphometric values are not distinct, except in the canine teeth, and determination of the sex randomly from a single tooth is extremely difficult. There has been no method for reliable determination of sex in single teeth regardless of whether it is permanent or deciduous teeth or an incisor or molar. [6],[7] With the development of DNA analysis, sex determination based on analysis of Y chromosomal DNA by amplification of specific alphoid centromeric repeat sequence using polymerase chain reaction (PCR) allowed more accurate sex determination. The X-chromosome specific alphoid repeat sequence can also be detected along with the Y-chromosome specific alphoid repeat sequence. [8] Therefore, DNA analysis of teeth through PCR for sex determination could be performed in bodies that were severely mutilated or skeletonized for forensic studies. However, it is important to know whether environmental stress conditions like extreme temperatures, physiochemical condition like sea water or decay after burying, influences the DNA content and their usability in PCR studies for sex determination. [9] Hence, this study aimed to determine sex using PCR method on DNA isolated from dental pulp, which was subjected to various environmental conditions created artificially to mimic a forensic scenario.

 Materials and Methods



Sample collection

This study was carried out in the Department of Oral surgery and Oral Pathology and Microbiology, SRM Dental College, Chennai, India. This study was approved by the institutional ethical committee and informed consent was obtained from all the patients who came for extraction, they were informed of the procedure details regarding tooth extraction and about the research. Total 15 teeth samples were collected. The extracted teeth were kept in normal saline until further use.

Employment of stress conditions

High temperature

Five teeth samples were subjected to varied temperatures using a dental furnace (SIRIO FIRE). Two teeth in this group were subjected to 100°C, and the other three teeth were subjected to 200°C, 300°C, and 400°C, respectively, for 15 min.

Immersion in sea water

Five teeth samples were kept immersed in sea water for a time period ranging from 20-36 days. Sea water was collected from Bay of Bengal in Chennai, India.

Burial in soil

Five teeth samples were buried in soil at a depth of 30 cm for a time period ranging from 20-36 days. The soil used for the study was taken from a depth of 4-5 feet. The soil was sandy, light, and dry and had lesser moisture content.

Extraction of pulp from teeth

The pulp tissue was extracted from teeth samples by splitting open the teeth using a hammer, and the dental pulp was manually recovered by using broaches and the tissue was transferred in to sterile micro centrifuge tubes of 1.5 ml capacity. To this, 1 ml sterile distilled water was added and stored in at −80° deep freezer.

DNA isolation from pulp and its quantification

A total of 1 ml of sterile distilled water was pipetted into a sterile 1.5-ml microcentrifuge tube and pulp tissue was added and mixed gently. The tube was incubated at room temperature for 30 min with gentle inversion and centrifuged for 5 min at 10,000 rpm, and the supernatant was discarded. Five percent Chelex 100 (Medox-Bio) in water was added to the final volume of 150 ΅l and 50 ΅l of proteinase K(2 mg/ml water) was added. The tube was then incubated at 56°C for 30 min. After the incubation, the tube was vortex-mixed at high speed for 10 s and incubated in a boiling water bath for 8 min. The tube was vortex-mixed at high speed for 10 s and centrifuged at 10,000 rpm for 5 min. The supernatant obtained contained the purified DNA. DNA in the solution was quantified by measuring the absorbance in spectrophotometer at a wavelength of 260 nm.

Polymerase chain reaction procedure

PCR amplification of the 172-base pair Y-chromosome-specific alphoid repeat sequence and the 131-base pair X-chromosome-specific alphoid repeat sequence by PCR was performed as described previously. Briefly, PCR was performed in a 100 ΅l PCR tubes using 30 ΅l reaction mixture volumes. The following were added in the PCR tube for gene amplification: PCR buffer (readymade mixture 5 ΅l), dNTP mix (1 ΅l), primer forward and reverse (1 ΅l each), DNA template (5 ΅l), Taq DNA polymerase (1 ΅l), and sterile distilled water (14 ΅l); all reagents were obtained from Mddox Biotech, Chennai. The sequence of the primers are XZ1 (female) (forward: AATCATCAAATGGAGATTTG, reverse: GTTCAGCTCTGTGAGTGAAA), and DYZ3 (male) (forward: ATGATAGAAACGGAAATATG, reverse: AGTAGAATGCAAATGGAGATTTG). The heating cycles of PCR were preheating at 95°C for 3 min and 35 heating cycles (denaturation at 95°C for 1 min, annealing at 55°C for 40 s, extension at 72°C for 2 min) and a final extension at 72°C for 10 s in a thermal cycler (Eppendorf Master Cycler). To avoid individual bias, the samples were double blinded and the samples were randomly given a separate allocation number.

Electrophoresis and sex determination

The PCR products were electrophoresed in 1% agarose solution in the buffer 0.5 Χ TEB at 100 V for 1 h, ethidium bromide staining was performed. The bands for Y and X specific sequences were examined under UV transilluminator. The sex of the subject was considered male when both Y- and X-specific sequences were detected and considered female when X-specific sequence was detected.

 Results



[Table 1] shows the yield of DNA from teeth after heating at varying temperatures. Out of the five samples subjected to varying temperatures, DNA extraction could be done only in three samples, which were subjected to 100°C and 200°C. Two samples that were subjected to 300°C and 400°C did not yield DNA. The yield of DNA from teeth after immersing in sea water is depicted in [Table 2]. DNA could be extracted in all five samples immersed in sea water for varying number of days ranging from 20 to 36. DNA could be extracted in all five samples buried in soil for varying number of days (20-6). Quantity of DNA obtained is shown in the tabular column [Table 3].{Table 1}{Table 2}{Table 3}

Quantification of DNA extracted by Chelex DNA Kit method was estimated using spectrophotometer. The amount of DNA from the samples that were kept at 100°C yielded 32 ΅g/ml of DNA, whereas sample kept at 200°C yielded 16 ΅g/ml of DNA. This result revealed that, as temperature increases, the amount of DNA decreases. Samples that were immersed for more number of days yielded less quantity of DNA. Samples that were immersed for 20 days yielded 34 ΅g/ml, and the amount of DNA kept decreasing as the number of days increased. Samples that were buried for more number of days yielded less quantity of DNA. Samples that were buried for 20 days yielded 25 ΅g/ml and the amount of DNA kept decreasing as the number of days increased.

To avoid individual bias, the samples were double blinded and the samples were randomly given a separate allocation number [Table 4]. A representative gel picture is shown in [Figure 1] depicting the method of sex determination after PCR analysis. From [Table 4], it was found that the results from PCR method of sex determination to be matching accurately with the subject.{Figure 1}{Table 4}

 Discussion



Forensic dentistry contributes to the forensic process by either a direct comparison of the deceased's dentition with that of known dental records or by enabling a profile of the individual regarding age at death, sex, in crime investigations involving biological evidence such as murder and sexual assault or in cases of mass disasters like the World Trade Center attacks and in identification of mutilated bodies and exhumed skeletons. [10] Recently, the method for sex determination using PCR was developed and its application to forensic medicine has been evaluated. In 1989, Witt and Erickson reported a method to amplify the specific alphoid centromeric repeat sequence by PCR and to determine sex based on blood stains. [11] This method allows more accurate sex determination since the X-chromosome specific alphoid repeat sequence can be detected along with the Y-chromosome specific alphoid repeat sequence. DNA analysis of teeth for sex determination is the best alternative in case of bodies that are markedly decayed or skeletonized bodies that provide no other materials. In such bodies, dental DNA is considerably decomposed and fragmented. [8] Therefore, a highly sensitive method, as described in the present study, would be suited for sex determination. The Y- and X-chromosome specific alphoid repeat sequences, which were examined in this study, can be repeatedly amplified several thousand times, respectively, by PCR, if part of these copies remains intact. Thus, the present study addressed whether the environmental stress conditions affects the DNA content of the teeth pulp and found that, except under high temperature, DNA can be isolated intact for PCR analysis.

The first phase of the study was carried out with the main objective of isolation of DNA from teeth pulp after subjecting to different temperatures, immersing in sea water, and burying in the soil. Out of the 15 samples taken for study, DNA could be extracted from only 13 samples. Teeth subjected to 300°C and 400°C did not yield any DNA. These results were similar to that reported by Murakami, [12] who did a study on sex determination using PCR using pulp tissue in 20 teeth samples by subjecting teeth to different temperatures, immersing in sea water, and burying in soil.

Urbani et al. [13] investigated the efficacy of utilizing DNA retrieved from the pulp of human teeth that had been exposed to different temperatures for different lengths of time in order to assess the sex. [14] In that study, PCR was shown to be 100% reliable when used to assess the gender of teeth, which had been heated at 100°C, but less reliable when the teeth were heated at higher temperatures for longer period of time. Similar to the above described study, our data showed sex determination to be possible in teeth samples subjected to temperatures 100°C and 200°C, but not possible in those subjected to 300°C and 400°C. Our study is in concordance with a study conducted by Tsuchimochi et al., [15] where the teeth incinerated at 400°C did not yield any PCR products. In our study, sex determination was possible in all teeth immersed in sea water and buried in soil. [13] Our results showed correlation with Murakami et al., [12] in which they were able to determine sex from teeth samples immersed in sea water for 4 weeks. This suggests that the wet condition does not cause autolytic degradation or decay of the DNA content inside the teeth. From these results, it could be emphasized that sex determination from pulp of teeth by means of PCR can be considered as extremely useful for identification of markedly decayed or skeletonized bodies, which is difficult using the conventional morphological methods.

The established importance of Forensic Dentistry for human identification happens, mainly when there is little remaining material to perform such identification (e.g., in fires, explosions, decomposing bodies, or skeletonized bodies). Dental identification is a very reliable method for personal identification of unknown, if the appropriate ante mortem record of the deceased person has been obtained. However, it is not easy to locate a candidate of certain unknown body using dental characteristics alone. In addition, even if a possible candidate can be located by some other means, sometimes, it is still difficult to find the dentist who treated the teeth of the candidate. Hence, teeth pulp offers another advantage as an aid in personal identification. They are good sources for DNA analysis, even in cases where the specimens are highly decomposed.

References

1Hanaoka Y, Minaguchi K. Sex determination from blood and teeth by PCR amplification of the alphoid satellite family. J Forensic Sci 1996;41:855-8.
2Sweet DJ, Sweet CH. DNA analysis of dental pulp to link incinerated remains of homicide victim to crime scene. J Forensic Sci 1995;40:310-4.
3Woodward SR, King MJ, Chiu NM, Kuchar MJ, Griggs CW. Amplification of ancient nuclear DNA from teeth and of tissues. PCR Methods Appl 1994;3:244-7.
4Sivagami AV, Rao AR, Varshney U. A simple and cost-effective method for preparing DNA from the hard tooth tissue, and its use in polymerase chain reaction amplification of amelogenin gene segment for sex determination in an Indian population. Forensic Sci Int 2000;110:107-15.
5Singh K, Anandani C, Bhullar RK, Agrawal A, Chaudhary H, Thakral A. Teeth and their Secrets-Forensic Dentistry. J Forensic Res 2012;3:141.
6Stavrianos C, Stavrianou I, Dietrich EM, Kafas P. Methods for human identification in Forensic Dentistry: A Review. Internet J Forensic Sci 2009;4:1.
7Schwartz GT, Dean C. Ontogeny of canine dimorphism in extant hominoids. Am J Phys Anthropol 2001;115:269-83.
8Morikawa T, Yamamoto Y, Miyaishi S. A new method for sex determination based on detection of SRY, STS and amelogenin gene regions with simultaneous amplification of their homologous sequences by a multiplex PCR. Acta Med Okayama 2011;65:113-22.
9Mukaida M, Kimura H, Takada Y, Masuda T, Nakata Y. The personal identification of many samples recovered from under the sea. Forensic Sci Int 2000;113:79-85.
10Rahiman S, Nissankararao P, Kumar PM. Restriction fragment length polymorphism (RFLP) application in DNA typing for Crime investigation. Indian J Forensic Med Toxicol 2010;4:79-82.
11Witt M, Erickson RP. A rapid method for detection of Y-chromosomal DNA from dried blood specimens by the polymerase chain reaction. Hum Genet 1989;82:271-4.
12Murakami H, Yamamoto Y, Yoshitome K, Ono T, Okamoto O, Shigeta Y, et al. Forensic study of sex determination using PCR on the teeth samples. Acta Med Okayama 2000;54:21-32.
13Urbani C, Lastrucci RD, Kramer B. The effect of temperature on sex determination using DNA-PCR analysis of dental pulp. J Forensic Odontostomotol 1999;17:35-9.
14von Wurmb-Schwark N, Bosinski H, Ritz-Timme S. What do the X and Y chromosomes tell us about sex and gender in forensic case analysis? J Clin Forensic Med 2007;14:27-30.
15Tsuchimochi T, Iwasa M, Maeno Y, Koyama H, Inoue H, Isobe I, et al. Chelating resin-based extraction of DNA from dental pulp and sex determination from incinerated teeth with Y-chromosomal alphoid repeat sand short tandem repeats. Am J Forensic Med Pathol 2002;23:268-71.